View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_high_54 (Length: 211)
Name: NF18747_high_54
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_high_54 |
 | |
|
| [»] scaffold1880 (1 HSPs) |
| | |
|
| [»] scaffold1462 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1880 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: scaffold1880
Description:
Target: scaffold1880; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 26 - 194
Target Start/End: Complemental strand, 530 - 362
Alignment:
| Q |
26 |
ccagtcaatcctgtcttctatatctacgtttcagacactaacaacacttaagcttgccgcttatacaaacccttgggtttatcaaaaaccattctttcca |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
530 |
ccagtcaatcctgtcttctatatctacgtttcagacactaacaacacttaagcttgccgtttatacaaacccttggatttatcacaaagcattctttcca |
431 |
T |
|
| Q |
126 |
gactctctgaaacttccgacattggttaatttggaactaacagatttcatctttagagatagtgaaaat |
194 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
430 |
gactatctgaaatttccgacattggttaatttggaactaactaatttcatctttagagatagtgaaaat |
362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1462 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: scaffold1462
Description:
Target: scaffold1462; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 26 - 194
Target Start/End: Original strand, 1230 - 1398
Alignment:
| Q |
26 |
ccagtcaatcctgtcttctatatctacgtttcagacactaacaacacttaagcttgccgcttatacaaacccttgggtttatcaaaaaccattctttcca |
125 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||||||||| ||||||||||| | | | | | ||||| |||||||||||||| |||| ||||| |
|
|
| T |
1230 |
ccagtcaatcctgtcatctatgtcttcgtttcagacactaacgtcacttaagcttcatgttaaaatacaccctagggtttatcaaaaagcattttttcct |
1329 |
T |
|
| Q |
126 |
gactctctgaaacttccgacattggttaatttggaactaacagatttcatctttagagatagtgaaaat |
194 |
Q |
| |
|
|||| ||||||| |||| |||||||||||||||||||||| |||| || |||||||||||||||||| |
|
|
| T |
1330 |
gactatctgaaatttccagcattggttaatttggaactaactaatttgatgtttagagatagtgaaaat |
1398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 26 - 194
Target Start/End: Original strand, 18316119 - 18316287
Alignment:
| Q |
26 |
ccagtcaatcctgtcttctatatctacgtttcagacactaacaacacttaagcttgccgcttatacaaacccttgggtttatcaaaaaccattctttcca |
125 |
Q |
| |
|
|||||||||||||||||| || || ||||||| |||||||| ||||||||||||| | | ||| | |||||||| || || ||| |||| ||||| |
|
|
| T |
18316119 |
ccagtcaatcctgtcttcaatgccttcgtttcaaacactaacgtcacttaagcttgctgttaatatacgcccttgggattctctcaaagcattttttcct |
18316218 |
T |
|
| Q |
126 |
gactctctgaaacttccgacattggttaatttggaactaacagatttcatctttagagatagtgaaaat |
194 |
Q |
| |
|
|||| ||||||| |||| |||||||||||||||||||||| |||| || ||||||||||| |||||| |
|
|
| T |
18316219 |
gactatctgaaatttccttcattggttaatttggaactaactaatttgatgtttagagatagggaaaat |
18316287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University