View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_24 (Length: 382)
Name: NF18747_low_24
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 246 - 321
Target Start/End: Original strand, 32920466 - 32920541
Alignment:
| Q |
246 |
cgacgatcaatttcactatccactagaggggatcaattgaaacctaattaactctgttaatgaagatttgtcacca |
321 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32920466 |
cgacgatcaattccactatccactagaggggaccaattgaaacctaattaactctgttaatgaagatttgtcacca |
32920541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 109 - 177
Target Start/End: Original strand, 11819407 - 11819475
Alignment:
| Q |
109 |
gttaacatgtttttgttccaatgtgcgagacatattttttacgtagctcataaaacacattattaacga |
177 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11819407 |
gttaacatgtttttgttccaataagctagacatattttttacgtggctcataaaacacattattaacga |
11819475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 41 - 89
Target Start/End: Original strand, 11819365 - 11819413
Alignment:
| Q |
41 |
gttgtatctaatttctaaagctagggtgcaagtagtggttacgttaaca |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11819365 |
gttgtatctaatttctaaagctagggtgcaagtagtggttatgttaaca |
11819413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University