View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_33 (Length: 308)
Name: NF18747_low_33
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 5656721 - 5656840
Alignment:
| Q |
1 |
cttggagtgcatattctttgtcagttccttttcatttagtttatgggaacccacaaacactcattaaaaaacgataaattggtttgccgttacaagacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656721 |
cttggagtgcatattctttgtcagttccttttcattttgtttatgggaacccacaaacactcattaaaaaacgataaattggtttgccgttacaagacat |
5656820 |
T |
 |
| Q |
101 |
ctttttgggcatgttcatgg |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
5656821 |
ctttttgggcatgttcatgg |
5656840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 154 - 282
Target Start/End: Original strand, 5656873 - 5657000
Alignment:
| Q |
154 |
tcatattttctactgtcatatccaaaaattgggattctttcattaaagtttcctttttaagtatannnnnnngtcataatgtataagattaaggatatga |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5656873 |
tcatattttctactgtcatatccaaaaattgggattctttcattaaagtttcctttttaagtata-ttttttgtcataatgtataagattaaggatatga |
5656971 |
T |
 |
| Q |
254 |
gaggagctataaaagttttgatatccttt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5656972 |
gaggagctataaaagttttgatatccttt |
5657000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University