View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_40 (Length: 279)
Name: NF18747_low_40
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_40 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 80 - 264
Target Start/End: Original strand, 5656632 - 5656820
Alignment:
| Q |
80 |
ttgtttgcgtggactaaggtttgattaatcaaaggtggcagaatcgagttgttaccaaaaccaaaagtaacacatgagnnnnnnn----cttggagtgca |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5656632 |
ttgtttgcgtggactaaggtttgattaatcaaaggtggcagaatcgagttgttaccaaaaccaaaagtaacacatgagtttttttttttcttggagtgca |
5656731 |
T |
|
| Q |
176 |
tattctttgtcagttccttttcatttagtttatgggaacccacaaacactcattaaaaaacgataaattggtttgccgttacaagacat |
264 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5656732 |
tattctttgtcagttccttttcattttgtttatgggaacccacaaacactcattaaaaaacgataaattggtttgccgttacaagacat |
5656820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University