View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_55 (Length: 239)
Name: NF18747_low_55
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_55 |
 | |
|
| [»] chr4 (3 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 118 - 239
Target Start/End: Original strand, 29866359 - 29866480
Alignment:
| Q |
118 |
gattcttacccactcaatgtttacgcagtaccaagaagaaaaagcgacgggctgttggaggtgataagaatggaagagggctccggcaatttagtatgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29866359 |
gattcttacccactcaatgtttacgcagtaccaagaagaaaaagcgacgggctgttggaggtgataagaatggaagagggctccggcaatttagtatgaa |
29866458 |
T |
|
| Q |
218 |
aggtttttcatctgtcttgttt |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29866459 |
aggtttttcatctgtcttgttt |
29866480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 29866260 - 29866324
Alignment:
| Q |
19 |
cgcgattcaaaacctttttatctatatccatactctgtggttttacaactcctgtcaattctttg |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29866260 |
cgcgattcaaaacctttttatctatatccatactctgtggttttacaactcctgtcaattctttg |
29866324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 174 - 234
Target Start/End: Original strand, 29871324 - 29871384
Alignment:
| Q |
174 |
ggaggtgataagaatggaagagggctccggcaatttagtatgaaaggtttttcatctgtct |
234 |
Q |
| |
|
||||||||||| | |||||||||||| || |||||||| ||||||||||||| |||||||| |
|
|
| T |
29871324 |
ggaggtgataaaagtggaagagggcttcgccaatttagcatgaaaggttttttatctgtct |
29871384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University