View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_56 (Length: 237)
Name: NF18747_low_56
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 7327338 - 7327111
Alignment:
| Q |
1 |
gttgataaggaagtgaatgtagtttcagaaatgtgtcctttcttgcattttaataaatatatttattagtaacattannnnnnnnnnnnnnnatctagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7327338 |
gttgataaggaagtgaatgtagtttcagaaatgtgtcctttcttgcattttaataaatatatttattagtaacattatttttttatttttttatctagtg |
7327239 |
T |
 |
| Q |
101 |
ttttaatctttaattagccttgtttagctatgtatgttgtcctttttggaatttaaaaaattctctctttcagagcatgtagcagacgaaaagattttat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327238 |
ttttaaactttaattagccttgtttagctatgtatgttgtcctttttggaatttaaaaaattctctctttcagagcatgtagcagacgaaaagattttat |
7327139 |
T |
 |
| Q |
201 |
ctatttcgctattatctatattgatgat |
228 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
7327138 |
ctatttcgctattatctatactgatgat |
7327111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University