View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_57 (Length: 236)
Name: NF18747_low_57
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 26 - 179
Target Start/End: Original strand, 3091650 - 3091803
Alignment:
| Q |
26 |
tcctacctacccgaagatgttatatgcgtatttttggaagacattcaaaattctttggtactattgatatgaatatacacaatttaaaataaattattgc |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3091650 |
tcctacctacccgaagatgttatatgcgtatttttggaagacattcaaaattctttggtactagtgatatgaatatacaaaatttaaaataaattattgc |
3091749 |
T |
 |
| Q |
126 |
aatatctcatcccatatttatccttaatttgcagaaacaaaaaatgcatatttt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3091750 |
aatatctcatcccatatttatccttaatttgcaaaaacaaaaaatgcatatttt |
3091803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University