View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_low_61 (Length: 222)
Name: NF18747_low_61
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 207
Target Start/End: Complemental strand, 35205450 - 35205270
Alignment:
| Q |
23 |
atattcttcttggtctgatcaaaccaattcaagtgcacccggccatggcgattatgtgagttattttatttctatacctgataatgatttactgctattg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205450 |
atattcttcttggtctgatcaaaccaattcaagtgcaccc----atggcgattatgtgagttattttatttctatacctgataatgatttactgctattg |
35205355 |
T |
|
| Q |
123 |
catttaatttcttataacacaccccttgtgtcacgtgttttgttgtttcactctcttgtccaacataagtcctttatagaattat |
207 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35205354 |
catttaatttcttataacacaccccctgtgtcacgtgttttgttgtttcactctcttgtccaacataagtcctttatagagttat |
35205270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University