View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18748_high_13 (Length: 246)
Name: NF18748_high_13
Description: NF18748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18748_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 230
Target Start/End: Original strand, 40551618 - 40551845
Alignment:
| Q |
3 |
cttccaacaatcagtccaacaaataccctgcttctgcactgttaatccgaagtcacatcacgggtgagtttggccagcccatagtggatgatggtacatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40551618 |
cttccaacaatcagtccaacaaataccctgcttctgcactgttaatccgaagtcacatcacgggtgagtttggccagcccatagtggatgatggtacatc |
40551717 |
T |
 |
| Q |
103 |
tgctgcatattattatgaacaggctgattagcattattgtagagtccaggtcccctactaaaattactattatgatcattttcttccgaggactcggttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40551718 |
tgctgcatattattatgaacaggctgattagcattattgtagagtccaggtcccctactaaaattactattatgatcattttcttccgaggactcggttg |
40551817 |
T |
 |
| Q |
203 |
aaggcccttgagaagtgggactagttgg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40551818 |
aaggcccttgagaagtgggactagttgg |
40551845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University