View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18748_low_10 (Length: 371)
Name: NF18748_low_10
Description: NF18748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18748_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 6 - 354
Target Start/End: Original strand, 5365773 - 5366121
Alignment:
| Q |
6 |
catatttaaaagttgttttcaacatttttctttagctcttaaagatagattatagaaataacttattttatatgaaaacaatagcctatctaagtgttta |
105 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365773 |
catatttaaaagttgttttcaacttttttctttagctcttaaagatagattttagaaataacttattttatatgaaaacaatagcctatctaagtgttta |
5365872 |
T |
 |
| Q |
106 |
attattttgcttattccagtaagtcctaaatccagatatcatgcgaggctttaaaactattgatctagttataaaggctataaaacttaaaaagtattgc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5365873 |
attattttgcttattccagtaagtcctaaatccagatatcatgcgaggctttaaaactattgatctagttatagaggctataaaacttaaaaagtattgc |
5365972 |
T |
 |
| Q |
206 |
agtggagtttgactctcaacttgctttaaaatttctttaggggttctcctccttgaatccttgttatggtgccatagcttggcctaaggtcttgacaatt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5365973 |
agtggagtttgactctcaacttgctttaaaatttctttaggggttctcctccttgaatccttgttatggtgccatagcttggcctaaggtcttgacaatt |
5366072 |
T |
 |
| Q |
306 |
tagagaagccagctttgtggttaaattgttggcaacatataatacttcg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5366073 |
tagagaagccagctttgtggttaaattgttggcaacatataatacttcg |
5366121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University