View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18748_low_14 (Length: 318)
Name: NF18748_low_14
Description: NF18748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18748_low_14 |
 |  |
|
| [»] scaffold0604 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 14 - 127
Target Start/End: Original strand, 6131179 - 6131292
Alignment:
| Q |
14 |
aatactgcaactaaaacatattagaaaagtaattctctaatatcttcttttttatacacctagtgaattttttctcaaatactatctcagactgtggcag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6131179 |
aatactgcaactaaaacatattagaaaagtaattctctaatatcttcttttttatacacctagtgaattttttctcaaatactatctcagattgtggcag |
6131278 |
T |
 |
| Q |
114 |
tccgcaagcaagtg |
127 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
6131279 |
tccgcaagcaagtg |
6131292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 192 - 300
Target Start/End: Original strand, 6131357 - 6131465
Alignment:
| Q |
192 |
gtcttccatgaaataaaaaactggtaagatttttagtttctttagttacagttgccagatttgcagcgacgatgaacaatgatacgagaaggtggaacga |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131357 |
gtcttccatgaaataaaaaactggtaagatttttagtttctttagttacagttgccagatttgcagcgacgatgaacaatgatacgagaaggtggaacga |
6131456 |
T |
 |
| Q |
292 |
tgtagaact |
300 |
Q |
| |
|
||||||||| |
|
|
| T |
6131457 |
tgtagaact |
6131465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 235 - 300
Target Start/End: Complemental strand, 16695840 - 16695775
Alignment:
| Q |
235 |
agttacagttgccagatttgcagcgacgatgaacaatgatacgagaaggtggaacgatgtagaact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16695840 |
agttacagttgccagatttgcagcgacgatgaacaatgatacgagaaggtggaacgatgtagaact |
16695775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0604 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: scaffold0604
Description:
Target: scaffold0604; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 235 - 300
Target Start/End: Original strand, 1545 - 1610
Alignment:
| Q |
235 |
agttacagttgccagatttgcagcgacgatgaacaatgatacgagaaggtggaacgatgtagaact |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
1545 |
agttacagttgccagatttgcagcgacgacgaacaatgatacgagaaggtggaacgatgtagaact |
1610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University