View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18748_low_17 (Length: 242)
Name: NF18748_low_17
Description: NF18748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18748_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 31 - 97
Target Start/End: Original strand, 52243023 - 52243089
Alignment:
| Q |
31 |
ggcttctgtccttttctttcagcaatactttgtttctttgctaacatcccccaaattcaaatactcc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52243023 |
ggcttctgtccttttctttcagcaatactttgtttctttgctaacatcccccaaattcaaatactcc |
52243089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 229
Target Start/End: Original strand, 52243189 - 52243221
Alignment:
| Q |
197 |
gtatccttgaagctgtctcatgtgattcctgat |
229 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
52243189 |
gtatccttcaagctgtctcatgtgattcctgat |
52243221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University