View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_high_13 (Length: 329)
Name: NF18749_high_13
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 120 - 315
Target Start/End: Original strand, 43601446 - 43601641
Alignment:
| Q |
120 |
taataaaatttgcggttacaaaaaacattttatcaagaatttgagttgttttagaaaataaattgtattatgagcttaactagtttatattccacattgg |
219 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43601446 |
taataaaatttgcggtttcaaaaaacattttatcaagaatttgagtttttttagaaaataaattgtattatgagcttaactagtttatattccacactgg |
43601545 |
T |
 |
| Q |
220 |
tttgaattaagaaaaaatgagtaaaatagaggaaataattattagtcttagtagtgttgtggcagttttaagggattacttgcaatgcaagtattg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601546 |
tttgaattaagaaaaaatgagtaaaatagaggaaataattattagtcttagtagtgttgtggcagttttaagggattacttgcaatgcaagtattg |
43601641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 6 - 83
Target Start/End: Original strand, 43601369 - 43601446
Alignment:
| Q |
6 |
agaagcaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt |
83 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43601369 |
agaaacaaaggaatataaatatgacataatggttaatgtgaatgagttaaggagtggagttataaagagacccgaggt |
43601446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University