View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18749_high_23 (Length: 249)

Name: NF18749_high_23
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18749_high_23
NF18749_high_23
[»] chr3 (1 HSPs)
chr3 (1-235)||(40952811-40953045)


Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40953045 - 40952811
Alignment:
1 ctctgcatattttgtttacatgcnnnnnnnagacttaattttcatatttgggtccgggtagtgcatgctttactgtcggtttgctgatcaggcatcttta 100  Q
    |||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40953045 ctctgcatattttgtttacatgctttttttagacttaattttcatatttgggtccgggtagtgcatgctttactgtcggtttgctgatcaggcatcttta 40952946  T
101 tagatgataagcattgtatgaagattgatgtctcgttgtgcttttgtaagttggatgtctcattgtgcttttgtgttcaaagaatcttcaactagcgtta 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
40952945 tagatgataagcattgtatgaagattgatgtctcgttgtgcttttgtaagatggatgtctcattgtgcttttgtgttcaaagaatcttcaactagcgtta 40952846  T
201 gcttttctgcaactgatagcatcatgcaagtgata 235  Q
    |||||||||||||||||||||||||||||||||||    
40952845 gcttttctgcaactgatagcatcatgcaagtgata 40952811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University