View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18749_high_26 (Length: 237)

Name: NF18749_high_26
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18749_high_26
NF18749_high_26
[»] chr6 (2 HSPs)
chr6 (1-132)||(29611632-29611761)
chr6 (192-221)||(29611821-29611850)


Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 29611632 - 29611761
Alignment:
1 gattggaaatacaagatttcttgcagaacagtatgcacttgacacttttgattgctcacatatatccaacaagatattagtaatatcatatggagaaaga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||    
29611632 gattggaaatacaagatttcttgcagaacagtatgcacttgacacttttgattgctcacatat--ccaacaagatattagtaatatcatatggagaaaga 29611729  T
101 tgcaaaatctcattgaagacatgatccagctc 132  Q
    ||||||||||||||||||||||||||||||||    
29611730 tgcaaaatctcattgaagacatgatccagctc 29611761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 221
Target Start/End: Original strand, 29611821 - 29611850
Alignment:
192 gcattcatggtggatgtcatggctcccata 221  Q
    ||||||||||||||||||||||||||||||    
29611821 gcattcatggtggatgtcatggctcccata 29611850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University