View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_high_7 (Length: 411)
Name: NF18749_high_7
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 18 - 397
Target Start/End: Original strand, 4926200 - 4926580
Alignment:
| Q |
18 |
agaacctgtgcagtgggaagattgaagaaaattattcccctctattttgatggcagcata-gcatttgtataactgaaaaaagagattgtaattggctat |
116 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4926200 |
agaaactgtgcagtgggaagattgaagaaaattattcccttctattttgatggcagcatatgcatttgtataactgaaaaaagagattgttattggctat |
4926299 |
T |
 |
| Q |
117 |
ttacaagaggaggataagaccagatttgattttttgtaatattgtaggatattcacgaaatttgagataaagggattattttatcttagatttaaatagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4926300 |
ttacaagaggaggataagaccagatttgattttttgtaatattgtaggatattcactaaatttgagataaagggattattttatcttagatttaattagg |
4926399 |
T |
 |
| Q |
217 |
cattggttgctaggttgcatcacagtaaatttaaataggattttatcttagaattaaaaggtaacagaataatgaagatttagtttaactggataattgc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
4926400 |
cattggttgctaggttgcatcacagtaaatttaaataggattttatcttagaattaaaaggtaatagaatattgaagatttagtttaactggataattgc |
4926499 |
T |
 |
| Q |
317 |
gtacttcattactgtttcacttctagcatttatgttggatgcttttacattattacatgctctttaagcacctatgatttg |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4926500 |
atacttcattactgtttcacttctagcatttatgttggatggttttacattattacatgctctttaagcacctatggtttg |
4926580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University