View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_17 (Length: 309)
Name: NF18749_low_17
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 16 - 271
Target Start/End: Original strand, 39342226 - 39342481
Alignment:
| Q |
16 |
atgaaggagcggtttgacttgctaagaatgaagcggcgtcatctttggacttacaaatacgggagaatttttccttctgatttatcatccattattattg |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |||||| |
|
|
| T |
39342226 |
atgaaggagcggattgacttgctaagaatgaagcggcgtcatctttggacttacaaatacgggataatttgtccttctgatttatcatccattgttattg |
39342325 |
T |
 |
| Q |
116 |
ttgatgcatgtggcatgaccgagatgcgtttgtagttttctgctttctttgttgctttagttttcccttaaaagaaaagttcactcattaactctctaca |
215 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39342326 |
ttgatgcatgtggcatgacccagatgcgtttgtagctttctgctttctttgttgctttagttttcccttaaaagaaaagttcactcattaactctctaca |
39342425 |
T |
 |
| Q |
216 |
gatgagtaaacaactattttctaagaaacattaactataattcctaaatatattaa |
271 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39342426 |
aatgagtaaataactattttctaagacacattaactataattcctaaatatattaa |
39342481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 184
Target Start/End: Original strand, 28943294 - 28943334
Alignment:
| Q |
144 |
tttgtagttttctgctttctttgttgctttagttttccctt |
184 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
28943294 |
tttgtagttttttgctttctttggtgctttagtttttcctt |
28943334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University