View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_26 (Length: 267)
Name: NF18749_low_26
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 267
Target Start/End: Complemental strand, 35762158 - 35761907
Alignment:
| Q |
17 |
atgtgggtttattccaagttaaactgataaacaaaaacccaaatatttagagaaaatgattgggtgatattaaattagaaagccctatacttggttgctt |
116 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762158 |
atgtgggtttattccaagttaaaccgataaacaaaaacccaaatatttagagaaaataattgggtgatattaaattagaaagccctatacttggttgctt |
35762059 |
T |
|
| Q |
117 |
gctaacttaannnnnnnnnnnnn-ctttcaaagaataattaataaacaaacatatttgagttaaagtgtccatggttgatgaactaaattgtgatccata |
215 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762058 |
gctaacttaattttttttttctttctttcaaagaataattaataaacaaacatatttgagttaaagtgtccatggttgatgaactaaattgtgatccata |
35761959 |
T |
|
| Q |
216 |
ttattcagtgtttccccttgaggagcttacgctcttcctctaactccaacaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35761958 |
ttattcagtgtttccccttgaggagcttacgctcttcctctaactccaacaa |
35761907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University