View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_27 (Length: 255)
Name: NF18749_low_27
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 13 - 242
Target Start/End: Complemental strand, 44454202 - 44453973
Alignment:
| Q |
13 |
atacttaaaagctaatttcaaaaactgaaatctgtgttgaagcttaacaactatttcacggcaacggtttggatcatgttccaaggacgacgcagtttcc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44454202 |
atacttaaaagctaatttcaaaaactgaaatctgtgttgaagcttaaaaactatttcacggcaacggtttggatcatgttccaaggacgacgcagtttca |
44454103 |
T |
|
| Q |
113 |
gcaaacggacgaagctgatcaagttcagaacgcagagcttggtggaaacaaacgaagaggagtataggagcatcgaagattggaaaacgtgaaagaatgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44454102 |
gcaaacggacgaagctgatcaagttcagaacgcagagcttggtggaaacaaacgaagaggagtataggagcatcgaagattggaaaacgtgaaagaatgt |
44454003 |
T |
|
| Q |
213 |
caactgaatcgttcaccatgacatcgtttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44454002 |
caactgaatcgttcaccatgacatcgtttt |
44453973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University