View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_28 (Length: 249)
Name: NF18749_low_28
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 40953045 - 40952811
Alignment:
| Q |
1 |
ctctgcatattttgtttacatgcnnnnnnnagacttaattttcatatttgggtccgggtagtgcatgctttactgtcggtttgctgatcaggcatcttta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40953045 |
ctctgcatattttgtttacatgctttttttagacttaattttcatatttgggtccgggtagtgcatgctttactgtcggtttgctgatcaggcatcttta |
40952946 |
T |
 |
| Q |
101 |
tagatgataagcattgtatgaagattgatgtctcgttgtgcttttgtaagttggatgtctcattgtgcttttgtgttcaaagaatcttcaactagcgtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40952945 |
tagatgataagcattgtatgaagattgatgtctcgttgtgcttttgtaagatggatgtctcattgtgcttttgtgttcaaagaatcttcaactagcgtta |
40952846 |
T |
 |
| Q |
201 |
gcttttctgcaactgatagcatcatgcaagtgata |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
40952845 |
gcttttctgcaactgatagcatcatgcaagtgata |
40952811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University