View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_31 (Length: 237)
Name: NF18749_low_31
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_31 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 29611632 - 29611761
Alignment:
| Q |
1 |
gattggaaatacaagatttcttgcagaacagtatgcacttgacacttttgattgctcacatatatccaacaagatattagtaatatcatatggagaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29611632 |
gattggaaatacaagatttcttgcagaacagtatgcacttgacacttttgattgctcacatat--ccaacaagatattagtaatatcatatggagaaaga |
29611729 |
T |
 |
| Q |
101 |
tgcaaaatctcattgaagacatgatccagctc |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29611730 |
tgcaaaatctcattgaagacatgatccagctc |
29611761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 192 - 221
Target Start/End: Original strand, 29611821 - 29611850
Alignment:
| Q |
192 |
gcattcatggtggatgtcatggctcccata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
29611821 |
gcattcatggtggatgtcatggctcccata |
29611850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University