View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18749_low_35 (Length: 212)
Name: NF18749_low_35
Description: NF18749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18749_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 43428351 - 43428523
Alignment:
| Q |
19 |
tcattagcccaacctcttgcagtcccacaaaccgccccaaatgccacaacttgcttgatattcactatttctttgtttgatgaagcaaccccaccacacc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
43428351 |
tcattagcccaacctcttgcagtcccacaaaccgccccaaatgccacaacttgcttgatatgcactatttctttgtttgatgaagcaaccc-----cacc |
43428445 |
T |
|
| Q |
119 |
acaccccccttatcaaaatgatgacaaaaatgcattctaataatgtggggtccacaattcaccttccaatagtttctt |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43428446 |
acaccccccttatcaaaatgatgagaaaaatgcattctaataatgtggggcccacaattcaccttccaatagtttctt |
43428523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University