View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1874_high_6 (Length: 234)
Name: NF1874_high_6
Description: NF1874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1874_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 39045261 - 39045471
Alignment:
| Q |
1 |
ttgattaatggagaattctttaattaattgatgttattactgtttattgctggcttgaggtcaagtttcatgggtgtactgtagtagcattttgatgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39045261 |
ttgattaatggagaattctttaattaattgatgttattactgtttattgctggcttgtggtcaaggt-catgggtgtactgtagtagcattttgatgtct |
39045359 |
T |
|
| Q |
101 |
cgtgatcgtgagttcagaaacggttcacgtgttggttttaatggagtagagtgggtgatgaggacgtggccactactactcctgcactgcactctcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39045360 |
cgtgatcgtgagttcagaaacggttcacgtgttggttttaatggagtagagtgggtgatgaggacgtggccactactactcctgcactgcactctcttct |
39045459 |
T |
|
| Q |
201 |
gtcttcactata |
212 |
Q |
| |
|
||||| |||||| |
|
|
| T |
39045460 |
gtctttactata |
39045471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University