View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18750_low_2 (Length: 251)
Name: NF18750_low_2
Description: NF18750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18750_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 247
Target Start/End: Original strand, 2694504 - 2694742
Alignment:
| Q |
9 |
gaagaaaatttcataggtggaggcgcctaagaaaggaaagcaacagtgggctgatcgtggtagaaacactcatgttggtacctcaggagttgctaccacc |
108 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2694504 |
gaagagaatttcagaggtggaggcgcctaagaaaggaaagcaacagtgggctgatcatggtagaaatactcatgttggtacctcaggagttgctaccacc |
2694603 |
T |
 |
| Q |
109 |
ggggtggttgagcgtacattagttcctcaagaagtgctcgaggagaatcatgaggtatcaaaggaacttccaggttgggatgtaggtcaagaagctgtcc |
208 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| | || |||||||||| ||| | ||| |
|
|
| T |
2694604 |
ggggcggttgagcgtacattagttcctcaacaagtactcgaggagaatcatgaggtatcaaaggaacttccagatcggcatgtaggtcataaagttttcc |
2694703 |
T |
 |
| Q |
209 |
attctgaggaggtatatgtgaacacagatgaaacagaaa |
247 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
2694704 |
gttctgatgaggaatatgtgaacacaaatgaaacagaaa |
2694742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University