View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18751_high_19 (Length: 222)
Name: NF18751_high_19
Description: NF18751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18751_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 6266236 - 6266050
Alignment:
| Q |
23 |
acactacctgttggcctataaatacccagtgagtg-gcttgactttctcacaagcttcctatctattttaacaatattgtggcttgattggaaagcaaaa |
121 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||| |
|
|
| T |
6266236 |
acactacttgttggcctataaatacgcagtgagtgtgcttgactttctcacaagcttcctatccattttaacaatattgtggcttgatcggtaagcaaaa |
6266137 |
T |
|
| Q |
122 |
atgtctttcctatttgggaatgataagatcaaaggcacattggtgctgatgcagaaaaatgtcttggacatcaacagcttaactgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6266136 |
atgtctttcctatttgggaatgataagatcaaaggcacattggtgctgatgcagaagaatgtcttggacatcaacagcttaactgat |
6266050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 6266972 - 6266944
Alignment:
| Q |
1 |
tgttattaaaaacaaaattgtaacactac |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6266972 |
tgttattaaaaacaaaattgtaacactac |
6266944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University