View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18751_high_20 (Length: 219)
Name: NF18751_high_20
Description: NF18751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18751_high_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 51967769 - 51967987
Alignment:
| Q |
1 |
tcttgtgcgccgctagaagaggaacgtctttccatgtggagttgcagacagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967769 |
tcttgtgcgccgctagaagaggaacgtctttccatgtggcgttgcagacagggcaaacaagggtagcatggttgcgtacatgtgctgctatgcaagggaa |
51967868 |
T |
|
| Q |
101 |
atgaaaagcatgtgcacattctgctgtgtatattgccttaccctgccctgttttcacgctattcaaacagattccacagctactctgaatcaaacaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51967869 |
atgaaaagcatgtgcacattctgctgtgtatattgccttcccctgccccgttttcacgctattcaaacagattccacagctactctgaatcaaacaataa |
51967968 |
T |
|
| Q |
201 |
tatcaaaataaataaggca |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51967969 |
tatcaaaataaataaggca |
51967987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University