View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18751_high_8 (Length: 363)
Name: NF18751_high_8
Description: NF18751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18751_high_8 |
 |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 3e-36; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 266 - 343
Target Start/End: Original strand, 21355389 - 21355466
Alignment:
| Q |
266 |
ttatagataatcttcttggtgctgttttatatgtacatgaaccattcgatcactccattcttggtgctgagaatttgt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21355389 |
ttatagataatcttcttggtgctgttttatatgtacatgaaccattcgatcactccattcttggtgctgagaatttgt |
21355466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 21146701 - 21146771
Alignment:
| Q |
106 |
taatcattgatttgcatcagagctaatttaggaaattagccaagtgtagtcacatgtcaatgttttcaatg |
176 |
Q |
| |
|
|||||||| ||||| |||||||| || ||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21146701 |
taatcattaatttgtatcagagccaagttaggaagttagccaattgtagtcacatgtcaatgttttcaatg |
21146771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 141 - 171
Target Start/End: Original strand, 21211383 - 21211413
Alignment:
| Q |
141 |
ttagccaagtgtagtcacatgtcaatgtttt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21211383 |
ttagccaagtgtagtcacatgtcaatgtttt |
21211413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 66 - 102
Target Start/End: Original strand, 21146420 - 21146456
Alignment:
| Q |
66 |
actaatatctatctagtgataattttataattcatta |
102 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
21146420 |
actaatatctatctagtgataattttaaagttcatta |
21146456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 61 - 93
Target Start/End: Original strand, 21258746 - 21258778
Alignment:
| Q |
61 |
tatgaactaatatctatctagtgataattttat |
93 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
21258746 |
tatgaactaatatctaactagtgataattttat |
21258778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 61 - 106
Target Start/End: Complemental strand, 63141 - 63096
Alignment:
| Q |
61 |
tatgaactaatatctatctagtgataattttataattcattacagt |
106 |
Q |
| |
|
||||||| |||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
63141 |
tatgaaccaatatccatctagtgataattttagaattcattacagt |
63096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 2322745 - 2322693
Alignment:
| Q |
1 |
agactaattgagagtacaaacttataagaaagtacaagtactttcactttata |
53 |
Q |
| |
|
||||||||||||||| |||||| |||||||||| || | ||||||||||||| |
|
|
| T |
2322745 |
agactaattgagagtgcaaactaataagaaagtttaactcctttcactttata |
2322693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University