View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18751_low_16 (Length: 250)
Name: NF18751_low_16
Description: NF18751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18751_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 2e-42; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 38 - 141
Target Start/End: Complemental strand, 4857581 - 4857478
Alignment:
| Q |
38 |
ctcatacctcgaatgtcaatgtatcttactttgtgtatatccatgagattccaattagctgttgaacctgggttcattaataatctcttatctttttaat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
4857581 |
ctcatacctcgaatgtcaatgtatcttactttgtttatatccatgagattacaattagctgttgaacctgggctcattaataatctcttatatttttaat |
4857482 |
T |
|
| Q |
138 |
taca |
141 |
Q |
| |
|
|||| |
|
|
| T |
4857481 |
taca |
4857478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 41 - 106
Target Start/End: Original strand, 5163121 - 5163189
Alignment:
| Q |
41 |
atacctcgaatgtcaatgtatcttact---ttgtgtatatccatgagattccaattagctgttgaacct |
106 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||| |||||||||| |
|
|
| T |
5163121 |
atacctcgaatgtcaatgtatcttactaatttgtttatatccatgagattacaattagttgttgaacct |
5163189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 224
Target Start/End: Original strand, 5163416 - 5163469
Alignment:
| Q |
171 |
taccagaggagtcgtcaccaccgtgctttcaaaattcagcattacttgccacac |
224 |
Q |
| |
|
|||||||| ||||||||||||| |||||| |||||||||||| |||||| |||| |
|
|
| T |
5163416 |
taccagagaagtcgtcaccaccatgctttaaaaattcagcatcacttgcaacac |
5163469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University