View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18752_high_16 (Length: 243)
Name: NF18752_high_16
Description: NF18752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18752_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 7299317 - 7299112
Alignment:
| Q |
16 |
gaaagttggtcagaaattttgaacttggattgagaaagataaccaactttttctctgcttgttgcagatcacacaccacagcatagagagtagactagag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7299317 |
gaaagttggtcagaaattttgaacttggattgagaaagataaccaactttttctctgcttgttgcagatcacac--cacagcatagaga----------- |
7299231 |
T |
|
| Q |
116 |
actacaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggtttattatg |
215 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7299230 |
-ctgcaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggtttattatg |
7299132 |
T |
|
| Q |
216 |
gtatgaaaagttgggaccat |
235 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7299131 |
gtatgaaaagttgggaccat |
7299112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University