View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18752_low_14 (Length: 287)
Name: NF18752_low_14
Description: NF18752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18752_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 31 - 264
Target Start/End: Complemental strand, 43314550 - 43314317
Alignment:
| Q |
31 |
ctcttgtagcaaatgttcgatgaaactagaaatcgacaacacaataaatggcttcccaattcctcaagtagatttgcacagaacccgaaagttgctctga |
130 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43314550 |
ctctcgtagcaaatgttcgatgaaactagaaatcgacaacacaataaatggcttcccaattcctcaagtagatttgcacagaacccgaaagttgttctga |
43314451 |
T |
 |
| Q |
131 |
ttgatcctcacaagtctggttcaagatctgcaatgtccgaatacggagatgatttgtatgactcatatgaagcaacatctcttccttgtcaaattccgcg |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43314450 |
ttgatcctcacaagtctggttcgagatctgcaatgtccgaatacggagatgatttgtatgactcctatgaagcaacatctcttccttgtcaaattccgcg |
43314351 |
T |
 |
| Q |
231 |
tcgaatctcagttcatgattgccaatattctcaa |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43314350 |
tcgaatctcagttcatgattgccaatattctcaa |
43314317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University