View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18752_low_15 (Length: 279)
Name: NF18752_low_15
Description: NF18752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18752_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 3202896 - 3202649
Alignment:
| Q |
17 |
ctaatgtctttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3202896 |
ctaatgtctttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaag |
3202797 |
T |
|
| Q |
117 |
tgtcatattagctggaatggatgttgctgttgatgatggtgttgatgttctttctctctcccttggacaaccctctacttctttctttgaaagtggaatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3202796 |
tgtcatattagctggaatggatgttgctgttgatgatggtgttgatgttctttctctctcccttggacaaccctctacttctttctttgaaagtggaatt |
3202697 |
T |
|
| Q |
217 |
gcacttggtgcatttagtgcaattcaaaagggaatttttgttagttgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3202696 |
gcacttggtgcatttagtgcaattcaaaagggaatttttgttagttgt |
3202649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 17 - 264
Target Start/End: Complemental strand, 3208870 - 3208623
Alignment:
| Q |
17 |
ctaatgtctttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaag |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||| ||||||| |
|
|
| T |
3208870 |
ctaatgtctttggtaatgctaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcaacatctacggttgtactgaaag |
3208771 |
T |
|
| Q |
117 |
tgtcatattagctggaatggatgttgctgttgatgatggtgttgatgttctttctctctcccttggacaaccctctacttctttctttgaaagtggaatt |
216 |
Q |
| |
|
| ||||||||||||||||||| ||| |||||||||| ||||||||| |||||||||||||| ||| |||||| || ||||||||||| ||||||| |
|
|
| T |
3208770 |
ttcaatattagctggaatggatgctgcagttgatgatgatgttgatgtactttctctctccctcggaggaccctcctctcctttctttgaagatggaatt |
3208671 |
T |
|
| Q |
217 |
gcacttggtgcatttagtgcaattcaaaagggaatttttgttagttgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3208670 |
gcacttggtgcatttagtgcaattcaaaaggggatttttgttagttgt |
3208623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 3216807 - 3216563
Alignment:
| Q |
19 |
aatgtctttggtaatgccaatggtactgcaattggcatggcaccatatgcacacttggcaatttacaaagtatgcggcgtctttggttgtgctgaaagtg |
118 |
Q |
| |
|
|||||||| || || || || ||||| |||| |||||||||||| |||||||||||||||| |||||||||||| || | ||||||| |||| |||| |
|
|
| T |
3216807 |
aatgtcttcggcaacgctaaaggtacggcaacaggcatggcaccagatgcacacttggcaatctacaaagtatgcagcagcagtggttgtcctgagagtg |
3216708 |
T |
|
| Q |
119 |
tcatattagctggaatggatgttgctgttgatgatggtgttgatgttctttctctctcccttggacaaccctctacttctttctttgaaagtggaattgc |
218 |
Q |
| |
|
| |||||| |||||||||| ||| ||||| || ||||||||||| ||||| |||||||| |||| | | ||||||||||| || |||||| |
|
|
| T |
3216707 |
caacattagcaggaatggatgctgcagttgaagacggtgttgatgtactttcaatctcccttaacggacccaccaaccctttctttgaagatgtaattgc |
3216608 |
T |
|
| Q |
219 |
acttggtgcatttagtgcaattcaaaagggaatttttgttagttg |
263 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
3216607 |
acttggtgcatttagtgcaaatcaaaagggaattttcgttagttg |
3216563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University