View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18752_low_16 (Length: 259)
Name: NF18752_low_16
Description: NF18752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18752_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 17 - 248
Target Start/End: Original strand, 9103635 - 9103866
Alignment:
| Q |
17 |
agatggaacaaactaaagaagtggagaatggagactacaatgaaagcaagaggattataacaaagcaatacatgatgattttggtcttctctttgttgat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9103635 |
agatggaacaaactaaagaagtggagaatggagactacaatgaaagcaagaggataataacaaagcaatacatgatgattttggtcttctctttgttgat |
9103734 |
T |
 |
| Q |
117 |
aagtatgcttggaggatctttgcttggatggtggcatcacaaatatcattcaacaaataggcaactttggatggtaccctttggtctcattttctttctt |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9103735 |
aagcatgcttggaggatctttgcttggatggtggcatcacaaatatcattcaacaaataggcaactttggatggtaccctttggcctcattttctttctt |
9103834 |
T |
 |
| Q |
217 |
actccactcattatttggttctcccttttcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9103835 |
actccactcattatttggttctcccttttcat |
9103866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University