View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18752_low_18 (Length: 243)

Name: NF18752_low_18
Description: NF18752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18752_low_18
NF18752_low_18
[»] chr1 (1 HSPs)
chr1 (16-235)||(7299112-7299317)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 16 - 235
Target Start/End: Complemental strand, 7299317 - 7299112
Alignment:
16 gaaagttggtcagaaattttgaacttggattgagaaagataaccaactttttctctgcttgttgcagatcacacaccacagcatagagagtagactagag 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||               
7299317 gaaagttggtcagaaattttgaacttggattgagaaagataaccaactttttctctgcttgttgcagatcacac--cacagcatagaga----------- 7299231  T
116 actacaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggtttattatg 215  Q
     || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7299230 -ctgcaaccaaatgagcaaaatctgtgtattcttttgagtctccaaaaggaattattattgcttaggaaaaatgatgcttttgctagttggtttattatg 7299132  T
216 gtatgaaaagttgggaccat 235  Q
    ||||||||||||||||||||    
7299131 gtatgaaaagttgggaccat 7299112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University