View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18753_high_7 (Length: 448)
Name: NF18753_high_7
Description: NF18753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18753_high_7 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 94; Significance: 1e-45; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 129 - 255
Target Start/End: Complemental strand, 94888 - 94760
Alignment:
| Q |
129 |
ttattgtcatcattatagttattgtcgttatagcactagcctctatatatata--gaagcttactatagcatctcaaatgcttgagtttgcaaaatggac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||||||||| |||||||| ||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
94888 |
ttattgtcatcattatagttattgtcgttattgcactagcttctatatatatatagaagcttattatagcatcgcaaatgcttgagtctgcaaaatggac |
94789 |
T |
 |
| Q |
227 |
tattcggtttccttctctaaagcccaaat |
255 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
94788 |
tattcggtttgcttctctaaagcccaaat |
94760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 95004 - 94967
Alignment:
| Q |
17 |
agatacctatatatattcacgtgtaacttgaattgatt |
54 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
95004 |
agatacctatatatattcacgggtaactttaattgatt |
94967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University