View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18753_low_14 (Length: 350)
Name: NF18753_low_14
Description: NF18753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18753_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 2e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 16 - 170
Target Start/End: Complemental strand, 36469520 - 36469354
Alignment:
| Q |
16 |
ataaatttgtacctcatcgtgagttattttcatattggatagcgatgttgggtgtggtatggaaacaacttaaattgcacctgcatgtgttaattttgag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36469520 |
ataaatttgtacctcatcgtgagttattttcatattggatagcgatgttgggtgtggtatggaaacaacttaaattgcacctgcatgtgttaattttgag |
36469421 |
T |
 |
| Q |
116 |
ttagtaagtttatgctttttt------------cttcttgttcaatgagaacgaataattatggtat |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36469420 |
ttagtaagtttatgcttttttgtgtactattcagttcttgttcaatgagaacgaataattatggtat |
36469354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 234 - 331
Target Start/End: Complemental strand, 36469290 - 36469193
Alignment:
| Q |
234 |
ctgatgttaattagttgcagagcaatgctatattcagcaacatatcatggttagtcaaagtttgataaacaggaaaaatcaattcgctatgcatttgc |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36469290 |
ctgatgttaattagttgcagagcaatgctatattcagcaacatatcatggttagtcaaagtttgataaacaggaaaaatcaattcgctatgcatttgc |
36469193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University