View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18753_low_15 (Length: 339)
Name: NF18753_low_15
Description: NF18753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18753_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 16 - 322
Target Start/End: Complemental strand, 45696042 - 45695736
Alignment:
| Q |
16 |
atattgattttatctacttttgtcgtcaattattagtgttattaaatagggaccggtttgtcacatagtgacagtactatagtagtggggcttgtttcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45696042 |
atattgattttatctacttttgtcgtcaattattagtgttattaaatagggaccggtttgtcacatagtgacagtactatagtagtggggcttgtttcag |
45695943 |
T |
 |
| Q |
116 |
gtttctgtgtctacaaactttgtttgtattgttcgcggtcaatgtagcgtatttatgttggtggcgtaagtttctgtgttttataactttgtttttcatt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695942 |
gtttctgtgtctacaaactttgtttgtattgttcgcggtcaatgtagcgtatttatgttggtagcgtaagtttctgtgttttataactttgtttttcatt |
45695843 |
T |
 |
| Q |
216 |
attgtttatgatgcccctgcatgagttataccacatgtctaaagaaaaagttgatcataaagtgatgaacaattcttgtgccccagatcaatcttctgtg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45695842 |
attgtttatgatgcccctgcatgagttataccacatgtctaaagaaaaagttgatcataaagagatgaacaattcttgtgccccagatcaatcttctgtg |
45695743 |
T |
 |
| Q |
316 |
taagttc |
322 |
Q |
| |
|
||||||| |
|
|
| T |
45695742 |
taagttc |
45695736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University