View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18754_high_1 (Length: 380)
Name: NF18754_high_1
Description: NF18754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18754_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 24 - 365
Target Start/End: Complemental strand, 29908340 - 29907999
Alignment:
| Q |
24 |
atcctctataaatagtcctggatttctttctgtttctgacaactcatctcattcttttctttttccgatttccgatctgctatggtttaaatcannnnnn |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
29908340 |
atcctctataaatagtcctggatttctttctgtttctcacaactcatctcattcttttctttttccgatttccaatctgctctggtttaaatcttttttt |
29908241 |
T |
|
| Q |
124 |
nnaatgtcttctgcaatgttgaaaggtgttaggtttgataacaagggtcttaggtctggtcacagaggtatcgcagctttgatttggtgtctgatgttgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
29908240 |
ttaatgtcttctgcaatgttgaaaggtgttaggtttgataacaagggtcttaggtctggtcacagaggtatcgcagctttgatttgctgtctgatgttct |
29908141 |
T |
|
| Q |
224 |
tcctggaaaggagtcttggggattcaagcttcatgttgttcgtttgtgggaggtgcgtgcttttcttcaatcataacagatcaattcgattgagatggtg |
323 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
29908140 |
tcctggaagagagtcttggagattcaagcttcgtgttgttcgtttgtgggaggtgcgtgattttcttcaatcataacagatcaattcaattgagatggtg |
29908041 |
T |
|
| Q |
324 |
tttgttgatgagaaggtttgtattgctgtttgtttgcctttg |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29908040 |
tttgttgatgagaaggtttgtattgctgtttgtttgcctttg |
29907999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 196 - 341
Target Start/End: Complemental strand, 29908984 - 29908839
Alignment:
| Q |
196 |
gcagctttgatttggtgtctgatgttgttcctggaaaggagtcttggggattcaagcttcatgttgttcgtttgtgggaggtgcgtgcttttcttcaatc |
295 |
Q |
| |
|
|||| |||||| || | ||||||| || ||||||||||||||||||| |||||| ||| ||| || ||| ||||||||| | ||| |||||||| | |
|
|
| T |
29908984 |
gcagttttgatctgttatctgatgctgctcctggaaaggagtcttggagattcattgttcgtgtggtgcgtctgtgggaggctcctgcgtttcttcatcc |
29908885 |
T |
|
| Q |
296 |
ataacagatcaattcgattgagatggtgtttgttgatgagaaggtt |
341 |
Q |
| |
|
||||| | |||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
29908884 |
tgaacaggtgaattcggttgagatggtgttggttgatgagaaggtt |
29908839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University