View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18755_high_8 (Length: 250)
Name: NF18755_high_8
Description: NF18755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18755_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 4 - 240
Target Start/End: Original strand, 45229831 - 45230068
Alignment:
| Q |
4 |
agtcccaatgctggcggagttgaacttacgtctttgtgggggtacgactcattgctatgtttgacattgattactggcagctctttttaatcaagagttg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45229831 |
agtcccaatgctggcggagttgaacttacgtctttgtgggggtacgactcattgctatgtttgacattgattactggcagctctttttaatcaagagttg |
45229930 |
T |
 |
| Q |
104 |
aactttctgtaaatttttgtaattttatattttatctggttctaatggttattccctatgtaattaaagataatttacttggtgcttttcagtttcatca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45229931 |
aactttctgtaaatttttgtaattttatattttatctggatctaatggttattccctatgtaattaaagataatttacttagtgcttttcagtttcatca |
45230030 |
T |
 |
| Q |
204 |
tttactttaa-gctaaaatgcacttttggctccctatg |
240 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45230031 |
tttactttaaggctaaaatgcacttttggctccctatg |
45230068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University