View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18755_low_10 (Length: 237)

Name: NF18755_low_10
Description: NF18755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18755_low_10
NF18755_low_10
[»] chr4 (2 HSPs)
chr4 (1-115)||(7353951-7354065)
chr4 (182-221)||(7360671-7360709)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 7353951 - 7354065
Alignment:
1 tgagtatttatggctggatgactaagtgcaagtatgcatggatcaagagttacagtataaaaagattgatgccatagggactgagcagctattgcttcat 100  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
7353951 tgagtatttatggctggatgactaagtgcaagtatgcacggatcaagagttacaatataaaaagattgatgccatagggactgagcagctattgcttcat 7354050  T
101 ttaactttctagtag 115  Q
    |||||||||||||||    
7354051 ttaactttctagtag 7354065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 7360671 - 7360709
Alignment:
182 agcttaatgtgtacttgtttttgaaattctacaaacattc 221  Q
    ||||||||||||||||||||| ||||||||||||||||||    
7360671 agcttaatgtgtacttgtttt-gaaattctacaaacattc 7360709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University