View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18755_low_10 (Length: 237)
Name: NF18755_low_10
Description: NF18755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18755_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 7353951 - 7354065
Alignment:
| Q |
1 |
tgagtatttatggctggatgactaagtgcaagtatgcatggatcaagagttacagtataaaaagattgatgccatagggactgagcagctattgcttcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7353951 |
tgagtatttatggctggatgactaagtgcaagtatgcacggatcaagagttacaatataaaaagattgatgccatagggactgagcagctattgcttcat |
7354050 |
T |
|
| Q |
101 |
ttaactttctagtag |
115 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7354051 |
ttaactttctagtag |
7354065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Original strand, 7360671 - 7360709
Alignment:
| Q |
182 |
agcttaatgtgtacttgtttttgaaattctacaaacattc |
221 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7360671 |
agcttaatgtgtacttgtttt-gaaattctacaaacattc |
7360709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University