View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18756_low_8 (Length: 219)
Name: NF18756_low_8
Description: NF18756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18756_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 7623399 - 7623530
Alignment:
| Q |
1 |
caagtcaatataaccaaaacttgttcatgactaaaaacacatactagctccttgaagatgcaaaacagcagtttgtattttcagaaaaatgtgaatacta |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623399 |
caagtcaatataagcaaaacttgttcatgactaaaaacacatactagctccttgaagatgcaaaacagcagtttgtattttcagaaaaatgtgaatacta |
7623498 |
T |
 |
| Q |
101 |
tatttttaatttaattttctgggaagattttt |
132 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |
|
|
| T |
7623499 |
tatttttaatttaattttctcggaagattttt |
7623530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 130 - 201
Target Start/End: Original strand, 7623691 - 7623762
Alignment:
| Q |
130 |
tttattctcttatataaaattcgaatgagtattaattttcaggttacaaaatgatgtgactctcgtataaat |
201 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7623691 |
tttattctcttagataaaattcaaatgagtattaattttcaggttacaaaatgatgtgactctcgtataaat |
7623762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University