View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_high_23 (Length: 395)
Name: NF18757_high_23
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_high_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 187 - 383
Target Start/End: Complemental strand, 44000026 - 43999830
Alignment:
| Q |
187 |
tctctgtgggcaaaaacgctgtaaaatagaaaagcatttcaaactctgtcttaggtttttattttatattagcccaacatcataaaattcaggtggacct |
286 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000026 |
tctctatgggcaaaaacgctgtaaaatagaaaagcatttcaaactctgtcttaggtttttattttatattagcccaacatcataaaattcaggtggacct |
43999927 |
T |
 |
| Q |
287 |
agtacctaacaaaaatgtattttgaggttatatctcttcagatgatgtgtgagactctgaccactttgcaaaatgtttcaagagaaagaaagatatt |
383 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43999926 |
attacctaacaaaaatgtattttgaggttatatctcttcagatgatgtgtgagactctgaccactttgcaaaatgtttcaagagaaagaaagatatt |
43999830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 104 - 177
Target Start/End: Complemental strand, 44000144 - 44000071
Alignment:
| Q |
104 |
ctaaagaggttgcgcttgtctcattttgcatgtgcattttacgagtcaaaatcagttttccagtcatattatta |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44000144 |
ctaaagaggttgcgcttgtctcattttgcatgtgcattttacgagtcaaaatcagttttccagtcatattatta |
44000071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University