View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_high_63 (Length: 238)
Name: NF18757_high_63
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_high_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 31531952 - 31531836
Alignment:
| Q |
66 |
ttggttcagttcgaattgttccattatagttt-ggttcagttcaaacgaattgaaaaacagttcagttcg-----gttcagacacagttttg-gtctaaa |
158 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
31531952 |
ttggttcagttcgaattgttccattatggttttggttcagttcaaacgaactgaaaaacagttcagttcggttcggttcagacacaattttgagtctaaa |
31531853 |
T |
|
| Q |
159 |
ctgaactttgcccatcc |
175 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
31531852 |
ttgaactttgcccatcc |
31531836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 11155072 - 11155016
Alignment:
| Q |
120 |
aaacagttcagttcggttcagacacagttttgg-tctaaactgaactttgcccatcc |
175 |
Q |
| |
|
||||||||| |||| ||||| |||||||||||| | | ||||||||||||||||||| |
|
|
| T |
11155072 |
aaacagttcggttcagttcaaacacagttttggatgtgaactgaactttgcccatcc |
11155016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 52421835 - 52421785
Alignment:
| Q |
125 |
gttcagttcggttcagacacagttttggtctaaactgaactttgcccatcc |
175 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52421835 |
gttcagttcagttttgacacagttttggtctaaactgaactttgcccatcc |
52421785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 42851554 - 42851519
Alignment:
| Q |
140 |
gacacagttttggtctaaactgaactttgcccatcc |
175 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42851554 |
gacacagtcttggtctaaactgaactttgcccatcc |
42851519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University