View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18757_high_63 (Length: 238)

Name: NF18757_high_63
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18757_high_63
NF18757_high_63
[»] chr5 (2 HSPs)
chr5 (66-175)||(31531836-31531952)
chr5 (120-175)||(11155016-11155072)
[»] chr3 (1 HSPs)
chr3 (125-175)||(52421785-52421835)
[»] chr4 (1 HSPs)
chr4 (140-175)||(42851519-42851554)


Alignment Details
Target: chr5 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 66 - 175
Target Start/End: Complemental strand, 31531952 - 31531836
Alignment:
66 ttggttcagttcgaattgttccattatagttt-ggttcagttcaaacgaattgaaaaacagttcagttcg-----gttcagacacagttttg-gtctaaa 158  Q
    ||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||||||||||||||||     ||||||||||| ||||| |||||||    
31531952 ttggttcagttcgaattgttccattatggttttggttcagttcaaacgaactgaaaaacagttcagttcggttcggttcagacacaattttgagtctaaa 31531853  T
159 ctgaactttgcccatcc 175  Q
     ||||||||||||||||    
31531852 ttgaactttgcccatcc 31531836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 120 - 175
Target Start/End: Complemental strand, 11155072 - 11155016
Alignment:
120 aaacagttcagttcggttcagacacagttttgg-tctaaactgaactttgcccatcc 175  Q
    ||||||||| |||| ||||| |||||||||||| | | |||||||||||||||||||    
11155072 aaacagttcggttcagttcaaacacagttttggatgtgaactgaactttgcccatcc 11155016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 125 - 175
Target Start/End: Complemental strand, 52421835 - 52421785
Alignment:
125 gttcagttcggttcagacacagttttggtctaaactgaactttgcccatcc 175  Q
    ||||||||| |||  ||||||||||||||||||||||||||||||||||||    
52421835 gttcagttcagttttgacacagttttggtctaaactgaactttgcccatcc 52421785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 175
Target Start/End: Complemental strand, 42851554 - 42851519
Alignment:
140 gacacagttttggtctaaactgaactttgcccatcc 175  Q
    |||||||| |||||||||||||||||||||||||||    
42851554 gacacagtcttggtctaaactgaactttgcccatcc 42851519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University