View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_high_75 (Length: 202)
Name: NF18757_high_75
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_high_75 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 33243969 - 33243885
Alignment:
| Q |
1 |
cccgcgaggcggtttcgggcgattttgttcattccagcgttttaaccatgtatcagtgcagaaactcttaaggtgaaaaatggga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33243969 |
cccgcgaggcggtttcgggcgattttgttcattccagcgttttaaccatgtatcagtgcagaaactcttaaggtgaaaaatggga |
33243885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 33264142 - 33264058
Alignment:
| Q |
1 |
cccgcgaggcggtttcgggcgattttgttcattccagcgttttaaccatgtatcagtgcagaaactcttaaggtgaaaaatggga |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33264142 |
cccgcgaggcggtttcgggcgattttgttcattccagcgttttaaccatgtatcagtgcagaaactcttaaggtgaaaaatggga |
33264058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 185
Target Start/End: Complemental strand, 33243820 - 33243785
Alignment:
| Q |
150 |
aagaagaagaaattgtggtgaagaaacggatagaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33243820 |
aagaagaagaaattgtggtgaagaaacggatagaat |
33243785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 185
Target Start/End: Complemental strand, 33263993 - 33263958
Alignment:
| Q |
150 |
aagaagaagaaattgtggtgaagaaacggatagaat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33263993 |
aagaagaagaaattgtggtgaagaaacggatagaat |
33263958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University