View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_low_48 (Length: 296)
Name: NF18757_low_48
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 64 - 280
Target Start/End: Complemental strand, 42793553 - 42793337
Alignment:
| Q |
64 |
aacatgtggattaatgatttgatttgatttgtaataaaacataacttgtccaagtccaaatcccagacgttataaaacagtgaatgatctgtaattataa |
163 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42793553 |
aacatgtggattaatgatttgatttgctttgtaataaaacataacttgtccaagtccaaatcccagacgttataaaacagtgaatgatctgtaattataa |
42793454 |
T |
|
| Q |
164 |
attccaaatgatacgtttctttcgaatattaaaaattaggtcaaataaaagaaaatatatttggatttaagtctattttgattggtttatgataaaaaac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42793453 |
attccaaatgatacgtttctttcgaatattaaaaattaggtcaaataaaagaaaatatatttggatttaagtctattttgattggtttatgataaaaaac |
42793354 |
T |
|
| Q |
264 |
gaatttaacaattttat |
280 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42793353 |
gaatttaacaattttat |
42793337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University