View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_low_62 (Length: 250)
Name: NF18757_low_62
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 18927623 - 18927856
Alignment:
| Q |
1 |
tgatcatatcttcatttttaagtaagttagactttactatttttgatcaactgaagttatgattatgatttgattaaagttttaaggaaactgannnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18927623 |
tgatcatatcttcatttttaagtaagttaggctttactatttttgatcaactgaagttatgattatgatttgattaaagttttaaggaaattgatatttt |
18927722 |
T |
 |
| Q |
101 |
n--cttcagaattctgcttgaactaccatctattggggttgatctgccatcttcctggtcgattgagttgtaatgtggtgttagcttcggtgaggctgat |
198 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18927723 |
tttcttcaaaattctgcttgaactaccatctattggggttgatctgccatcttcctggtcgattgagttgtaatgtggtgttagcttcggtgaggctgat |
18927822 |
T |
 |
| Q |
199 |
cgtcaaccctctgtgagatggaggggggctgtgt |
232 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||| |
|
|
| T |
18927823 |
cgtcaaccctcggtgagatggagggtggttgtgt |
18927856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University