View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18757_low_64 (Length: 248)
Name: NF18757_low_64
Description: NF18757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18757_low_64 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 109
Target Start/End: Complemental strand, 5988532 - 5988435
Alignment:
| Q |
12 |
tattctatctgggccacggtttattttggaattttcagtcttcaaagtattgaaattttgccgcattattatgttgagtagttactcacacccaatat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
5988532 |
tattctatctgggccacggtttattttggaattttcaggcttcaaagtattgaaattttgcagcattatcatgtggagtagttattcacacccaatat |
5988435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 143 - 211
Target Start/End: Complemental strand, 5988429 - 5988361
Alignment:
| Q |
143 |
catttaattatttcaaaaaagtagtgatgctccagcaattgtgttttaacaaatgggctaaacttctac |
211 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
5988429 |
catttcattatttcaaaaaagaagtgatgctccagcaattgtcttttaacaaaagggctaaacttctac |
5988361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University