View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18758_low_12 (Length: 242)
Name: NF18758_low_12
Description: NF18758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18758_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 31325967 - 31326169
Alignment:
| Q |
20 |
gaatatttggaatatctctattagattctctttttcatagtcacaatactttctatcaaatttttcctgaacttattagtgcctatatatatatttttgc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31325967 |
gaatatttggaatatctctattagattctctctttcatagtcacaatactttctatcaaatttttcctgaacttattagtgc-tatatatatatttttgc |
31326065 |
T |
 |
| Q |
120 |
ttgaaatatgtactaaattaatcatgtgttttattgaaggaacaaaacatcactgtcaccattgaatcggtaccaattaagagctcacattcattgcctt |
219 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31326066 |
ttgaaatatgtactacattaatcatgtgttttattgaaggaacaaaacatcactgtcaccattgaatcggtaccaattaagagctcacattcattgcctt |
31326165 |
T |
 |
| Q |
220 |
gttc |
223 |
Q |
| |
|
|||| |
|
|
| T |
31326166 |
gttc |
31326169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University