View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18758_low_5 (Length: 339)
Name: NF18758_low_5
Description: NF18758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18758_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 6e-68; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 186 - 324
Target Start/End: Complemental strand, 6130907 - 6130769
Alignment:
| Q |
186 |
gtacttgcgtaaacaatatttgttccctaactttatgtgatatgtgatacatcctctaggtaaaattttcaggttgctgaaatcttttgcgggtaccgtg |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6130907 |
gtacttgcgtaaacaatatttgttccctaactttatgtgatatgtgatacatcctctaggtaaaattctcaggttgctgaaatcttttgcgggtaccgtg |
6130808 |
T |
 |
| Q |
286 |
acaaaagttagaaagtattgtccttcaataatgtcatat |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6130807 |
acaaaagttagaaagtattgtccttcaataatgttatat |
6130769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 6131092 - 6130958
Alignment:
| Q |
1 |
gtatgtttttaagatgagtgttagcaatacactctcaaatattaatcattaacaaaataattatatagattaaaactgataaaatttgtatgaattttaa |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6131092 |
gtatgtttttaagatgagtattagcaatacactctcaaatattaatcattaacaaaataattatatagattaaaactgataaaatttgtatgaattttaa |
6130993 |
T |
 |
| Q |
101 |
ccaataaaatagtgtgtattggtaagagaattacc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6130992 |
ccaataaaatagtgtgtattggtaagagaattacc |
6130958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 226 - 279
Target Start/End: Complemental strand, 6861358 - 6861305
Alignment:
| Q |
226 |
tatgtgatacatcctctaggtaaaattttcaggttgctgaaatcttttgcgggt |
279 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
6861358 |
tatgtgataccttgtctaggtaaaattttcaggttggtgaaatctcttgcgggt |
6861305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University