View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18759_low_11 (Length: 291)
Name: NF18759_low_11
Description: NF18759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18759_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 55955644 - 55955907
Alignment:
| Q |
18 |
gccttcactaatccaaattccagaattcgtttgcgaagcaatcaatattgcaaccgacgaacacaattgaaagatttaatacatgtcatgtttatgataa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55955644 |
gccttcactaatccaaattccagaattcgtttgtgaagcaatcaatattgcgaccgacgaacacaattgaaagatttaatacatgtcatgtttatgataa |
55955743 |
T |
|
| Q |
118 |
agtacaaagtatagatctagttttaacaactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcg |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55955744 |
attacaaagtatagatctagttttaacaactaacccacaggacggctttgacattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcg |
55955843 |
T |
|
| Q |
218 |
caaaagaacatcaactagattttcaccctgtttgccatggattgaatttgattgatgccctttg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55955844 |
caaaagaacatcaactagattttcaccctgtttgccatggattgaatttgattgatgctctttg |
55955907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 275
Target Start/End: Original strand, 55959226 - 55959345
Alignment:
| Q |
159 |
acggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcaccctgtttgc---cat |
255 |
Q |
| |
|
|||||||||| ||| || | |||||| |||| |||| || | ||||||| ||||||||||||||||||||||||| ||||||| | || ||| ||| |
|
|
| T |
55959226 |
acggctttgacattctcttgtgtgattgggacctcgagatagccactttgttgaacgcgcaaaagaacatcaactaaattttcatcttgcatgccggcat |
55959325 |
T |
|
| Q |
256 |
ggattgaatttgattgatgc |
275 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
55959326 |
ggattgaatttgtttgatgc |
55959345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 12266716 - 12266617
Alignment:
| Q |
145 |
aactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcacc |
244 |
Q |
| |
|
|||||||||||| |||||||||| |||||| | |||||| ||||||| | | || | |||||||||| ||||| |||||||||||||| ||||||||| |
|
|
| T |
12266716 |
aactaacccatatcacggctttgacattgtcatgtgtgattgggatattaagactgccgctttgctgaatgcgcagaagaacatcaactatattttcacc |
12266617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 244
Target Start/End: Original strand, 12426104 - 12426203
Alignment:
| Q |
145 |
aactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcacc |
244 |
Q |
| |
|
|||||||||| | |||||||||| |||||| | ||| || ||||| |||| | || || |||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
12426104 |
aactaacccagattacggctttgacattgtcttgtgttattgggatctcgagactgctacgttgctggatgcgcaaaagaacatctactagattttcacc |
12426203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University