View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18759_low_11 (Length: 291)

Name: NF18759_low_11
Description: NF18759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18759_low_11
NF18759_low_11
[»] chr4 (2 HSPs)
chr4 (18-281)||(55955644-55955907)
chr4 (159-275)||(55959226-55959345)
[»] chr6 (2 HSPs)
chr6 (145-244)||(12266617-12266716)
chr6 (145-244)||(12426104-12426203)


Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 55955644 - 55955907
Alignment:
18 gccttcactaatccaaattccagaattcgtttgcgaagcaatcaatattgcaaccgacgaacacaattgaaagatttaatacatgtcatgtttatgataa 117  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
55955644 gccttcactaatccaaattccagaattcgtttgtgaagcaatcaatattgcgaccgacgaacacaattgaaagatttaatacatgtcatgtttatgataa 55955743  T
118 agtacaaagtatagatctagttttaacaactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcg 217  Q
    | ||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
55955744 attacaaagtatagatctagttttaacaactaacccacaggacggctttgacattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcg 55955843  T
218 caaaagaacatcaactagattttcaccctgtttgccatggattgaatttgattgatgccctttg 281  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
55955844 caaaagaacatcaactagattttcaccctgtttgccatggattgaatttgattgatgctctttg 55955907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 275
Target Start/End: Original strand, 55959226 - 55959345
Alignment:
159 acggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcaccctgtttgc---cat 255  Q
    |||||||||| ||| || | |||||| ||||  |||| || | ||||||| ||||||||||||||||||||||||| ||||||| | ||  |||   |||    
55959226 acggctttgacattctcttgtgtgattgggacctcgagatagccactttgttgaacgcgcaaaagaacatcaactaaattttcatcttgcatgccggcat 55959325  T
256 ggattgaatttgattgatgc 275  Q
    |||||||||||| |||||||    
55959326 ggattgaatttgtttgatgc 55959345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 145 - 244
Target Start/End: Complemental strand, 12266716 - 12266617
Alignment:
145 aactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcacc 244  Q
    ||||||||||||  |||||||||| |||||| | |||||| |||||||  | | || | |||||||||| ||||| |||||||||||||| |||||||||    
12266716 aactaacccatatcacggctttgacattgtcatgtgtgattgggatattaagactgccgctttgctgaatgcgcagaagaacatcaactatattttcacc 12266617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 244
Target Start/End: Original strand, 12426104 - 12426203
Alignment:
145 aactaacccataggacggctttgatattgtcgtctgtgatagggatatcgaaattgtcactttgctgaacgcgcaaaagaacatcaactagattttcacc 244  Q
    |||||||||| |  |||||||||| |||||| | ||| || ||||| |||| | ||  || |||||| | ||||||||||||||| ||||||||||||||    
12426104 aactaacccagattacggctttgacattgtcttgtgttattgggatctcgagactgctacgttgctggatgcgcaaaagaacatctactagattttcacc 12426203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University