View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18759_low_14 (Length: 249)
Name: NF18759_low_14
Description: NF18759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18759_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 241
Target Start/End: Complemental strand, 31755997 - 31755766
Alignment:
| Q |
10 |
ctcgatcgaagacattgacaaccggattattggtttttgcaattgttggatcagtgggaggttttattggtatatgtacaataatttattgtttatggac |
109 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31755997 |
ctcgatcgaagactttgacaaccggattattggtttttgcaattgttggatcagtgggaggttttattggtatatgtacaataatttattgtttatggac |
31755898 |
T |
 |
| Q |
110 |
aggtgtttgttttgggaaaaagaaagttcatagttctgtgcaaccaacagtcacaagaggtagtagcaacagttcaaattcaagtgcatcttcgataaaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31755897 |
aggtgtttgttttgggaaaaagaaagttcacagttctgtgcaaccaacagtcacaagaggtagtagcaacagttcaaattcaagtgcatcttcgataaaa |
31755798 |
T |
 |
| Q |
210 |
tcggtcattatgcgtcaaggttcgagaataat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31755797 |
tcggtcattatgcgtcaaggttcgagaataat |
31755766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 170
Target Start/End: Complemental strand, 35559131 - 35559055
Alignment:
| Q |
94 |
tttattgtttatggacaggtgtttgttttgggaaaaagaaagttcatagttctgtgcaaccaacagtcacaagaggt |
170 |
Q |
| |
|
|||||||||| |||| ||||| |||||||| || ||||||||||| | ||| || ||||||||| |||| |||||| |
|
|
| T |
35559131 |
tttattgtttgtggagtggtgtgtgttttggtaagaagaaagttcacaattccgttcaaccaacaatcactagaggt |
35559055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University